Rclin swiss sa
WebAt RCLIN we believe that molecular medicine is the key to personalized health, which helps to prevent and treat diseases much better than the “one-size-fits-all” approach. RCLIN's Center for Molecular Medicine provides patient-specific programs that work to address the underlying causes of diseases in the most effective and health enhancing way. WebFree and open company data on Switzerland company RCLIN SA (company number 1014982), Rue du Lac, 10, Clarens, 1815
Rclin swiss sa
Did you know?
WebDR PRUSS is an australia trademark and brand of RCLIN SA, ,SWITZERLAND. This trademark was filed to IP Australia on Thursday, March 7, 2024. The DR PRUSS is under the trademark classification: Medical, Beauty & Agricultural Services ; Pharmaceutical Products; The DR PRUSS trademark covers Medical services; veterinary services; hygienic and beauty care … WebAbout the company RCLIN Swiss SA. RCLIN Swiss SA, based in Clarens, is a company in Switzerland. RCLIN Swiss SA is active according to the commercial register. The …
WebFind company research, competitor information, contact details & financial data for RCLIN Swiss SA of Clarens, VAUD. Get the latest business insights from Dun & Bradstreet. WebWho is RCLIN Swiss. RCLIN is specializing in molecular medicine. Our multidisciplinary team of lab technicians and medical doctors, bio scientists and pharmacologists looks at physical, chemical, and biological make up of each individual patient to understand the unique cellular inter actions and identify any molecular and genetic errors that may lead to or have …
WebSWISS Senses Learn more. Travel ID. Unlimited access to Lufthansa Group Airlines and Miles & More. Register now. Travel preparations. We have put together the most important tips and services related to your trip for you. To travel preparations. Earn … WebAbout Us. RCLIN Pharma, Food and Beauty is a product manufacturing division of RCLIN Life Sciences Group, based in Switzerland. RCLIN Pharma, Food and Beauty was …
WebDr. Elena Pruss, PhD. is the owner and Medical Director of RCLIN Group, where she is responsible for strategic management of the medical services, research and …
WebRCLIN Swiss SA, a company established under the laws of Switzerland, operates Swiss Center for Genetics as one of its service divisions that provides laboratory and medical … greenworks pressure washer electricWebAt RCLIN we believe that molecular medicine is the key to personalized health, which helps to prevent and treat diseases much better than the “one-size-fits-all” approach. RCLIN's … foam trucker hat wholesaleWebHold the cursor over a type above to highlight its positions in the sequence below. AGAGTATCTTAAAAGGAAAAACAGAG greenworks pressure washer gpw2301WebFind company research, competitor information, contact details & financial data for RCLIN SA of Clarens, VAUD. Get the latest business insights from Dun & Bradstreet. foam trucker hat manufacturerhttp://www.revipharma.it/en/ greenworks pressure washer filterWebCustomers, who viewed CIC Riviera SA, were also interested in: RCLIN Swiss SA 1815 Clarens, Switzerland Clinique La Prairie S.A. 1815 Clarens, Switzerland Clinique La Prairie Holistic Health SA 1815 Clarens, Switzerland foam truck bed mattressWebRCLIN Group was founded in 2002 and is owned by the Pruss Family. RCLIN Group operates medical centers and laboratories in the domain of molecular medicine, maintains a … greenworks pressure washer gun replacement